Tomato Functional Genomics Database (TFGD)

Tomato sRNA S22423035

Sequence	Length	annotation
UCGCUUGGUGCAGGUCGGGAC	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	2862	278.89
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1169	154.95
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	346	40.42
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1186	255.4
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	157589	11623.8
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	650	271.81
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	116	118.62
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	1161	292.23
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	375	106.28
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	1066	272.73
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	968	466.28
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	388	322.33
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	625	354.38
S0708	Solanum lycopersicum	MicroTom	flower, open	536	165.38
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	808	212.12
S0373	Solanum lycopersicum	Heinz 1706	fruit	1483	443.88
S0372	Solanum lycopersicum	Heinz 1706	flower	1544	467.28
S0371	Solanum lycopersicum	Heinz 1706	leaf	8707	2623.78

S22423035 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc08g005690	118	138	-	click here