Tomato sRNA S19943155
Sequence | Length | annotation |
GUUGACGGCGUUAGAUUGAUAUA | 23 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 24 | 1.77 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 453 | 349.09 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 298 | 226.06 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 258 | 183.81 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 321 | 236.41 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 643 | 401.49 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 333 | 212.14 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 405 | 266.92 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 418 | 255.54 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 386 | 231.06 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 268 | 261.49 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 515 | 300.64 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 204 | 200.11 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 380 | 268.75 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 496 | 539.95 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 674 | 643.98 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 393 | 1135.27 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 580 | 404.05 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 584 | 779.31 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 199 | 83.21 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 43 | 43.97 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 185 | 46.57 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 260 | 73.69 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 296 | 75.73 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 44 | 21.19 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 31 | 25.75 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 16 | 9.07 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 100 | 30.85 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 177 | 46.47 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|