Tomato sRNA S14954211

SequenceLengthannotation
CUUGGAACCACAGUUACCACC21miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)30.35
S0735Solanum lycopersicumSunnyleaf , TSWV-infected10.07
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 10.77
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate3111108.3
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate22816.35
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate176.87
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate212487.7
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate12931.57
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate276.69
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate13189.55
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate111.33

S14954211 mapped to the follwoing genes

gene IDstart positionstop positionstrandexpression
Solyc12g0113502444+click here