Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
ACAUGUGGGACCAGCGCGGAGUGA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	5	0.49
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	6	0.7
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	21	4.52
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	5918	436.51
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	1	0.74
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	1	0.62
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	1	1.33
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	4	1.67
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	9	2.27
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	11	3.12
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	9	2.3
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	3	1.45
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	1	0.57
S0708	Solanum lycopersicum	MicroTom	flower, open	1	0.31
S0373	Solanum lycopersicum	Heinz 1706	fruit	6	1.8
S0372	Solanum lycopersicum	Heinz 1706	flower	4	1.21
S0371	Solanum lycopersicum	Heinz 1706	leaf	5	1.51