Tomato Functional Genomics Database (TFGD)

Tomato sRNA S02673911

Sequence	Length	annotation
AAGCUGACGGCGUUAGAUUGAUA	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	3	0.29
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	2	0.27
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	4	0.47
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1	0.07
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	77	59.34
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	39	29.59
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	28	19.95
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	63	46.4
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	96	59.94
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	61	38.86
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	66	43.5
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	68	41.57
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	72	43.1
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	140	136.6
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	212	123.76
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	173	169.7
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	146	103.26
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	48	52.25
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	68	64.97
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	48	138.66
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	20	13.93
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	77	102.75
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	48	20.07
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	8	8.18
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	35	8.81
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	32	9.07
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	103	26.35
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	22	10.6
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	13	10.8
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	11	6.24
S0708	Solanum lycopersicum	MicroTom	flower, open	38	11.72
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	64	16.8
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0371	Solanum lycopersicum	Heinz 1706	leaf	1	0.3