Tomato Functional Genomics Database (TFGD)

sequence	Length	miRNA family	sRNA ID	target
UUGGCUGAGUGAGCAUCACGG	21	NA	S25628348	click here

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	24295	2367.42
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	8219	1089.39
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	5341	623.95
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	11178	2407.1
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	75224	5548.51
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	3508	1466.92
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	185	189.17
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	3038	764.68
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	1741	493.44
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	4830	1235.71
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	1308	630.06
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	442	367.19
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	387	219.43
S0708	Solanum lycopersicum	MicroTom	flower, open	1995	615.55
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	1146	300.86
S0373	Solanum lycopersicum	Heinz 1706	fruit	81477	24387.2
S0372	Solanum lycopersicum	Heinz 1706	flower	25220	7632.62
S0371	Solanum lycopersicum	Heinz 1706	leaf	56940	17158.4

No hits on known miRNAs were found

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch12	1977866	1977757	-	CUCAGGUGCUCACUCAGCUA AUAGUUAUUAUUUAAGAAAC UCAAUAAUAUUGGCAGCAAG GAGAAUGGUGACUUUCAGGA UGAUAACUAUUGGCUGAGUG AGCAUCACGG	-50.60	NA	structure